After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ANXA6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ANXA6cDNA Clone Product Information
cDNA Size:2022
cDNA Description:ORF Clone of Homo sapiens annexin A6 DNA.
Gene Synonym:ANX6, CBP68, ANXA6
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1608 T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human ANXA6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Size / Price
    List Price: $345.00  (Save $30.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human ANXA6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items