After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human NLGN3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NLGN3 cDNA Clone Product Information
RefSeq ORF Size:2487bp
cDNA Description:Full length Clone DNA of Homo sapiens neuroligin 3 with Flag tag.
Gene Synonym:HNL3, ASPGX1, AUTSX1, KIAA1480, NLGN3
Restriction Site:KpnI + XhoI (5.4kb + 2.54kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Neuroligin 3 (NLGN3) is a member of the type-B carboxylesterase/lipase family. Neuroligins (NLGNs) are a family of presumptive postsynaptic cell adhesion molecules. Neuroligins (NLs) constitute a family of cell-surface proteins that interact with neurexins (beta-Nxs), another class of neuronal cell-surface proteins, one of each class functioning together in synapse formation. Neuroligins control the formation and functional balance of excitatory and inhibitory synapses in hippocampal neurons. NLGN1 and NLGN2 isoforms are concentrated at glutamatergic and GABAergic synapses, respectively, but the cellular expression and synaptic localization of the endogenous. NLGN3 was enriched in brain, where NLGN3 protein levels increased during postnatal development, coinciding with the peak of synaptogenesis. The NLGN3 is a synaptic adhesion molecule that is a shared component of glutamatergic and GABAergic synapses. Mutations in NLGN3 gene may be associated with autism and Asperger syndrome.

  • Chih B, et al. (2005) Control of excitatory and inhibitory synapse formation by neuroligins. Science. 307(5713): 1324-8.
  • Paraoanu LE, et al. (2006) Expression patterns of neurexin-1 and neuroligins in brain and retina of the chick embryo: Neuroligin-3 is absent in retina. Neurosci Lett. 395(2): 114-7.
  • Budreck EC, et al. (2007) Neuroligin-3 is a neuronal adhesion protein at GABAergic and glutamatergic synapses. Eur J Neurosci. 26(7): 1738-48.
  • Size / Price
    Catalog: HG11160-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions