After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human GADD45A ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GADD45A cDNA Clone Product Information
RefSeq ORF Size:498bp
cDNA Description:Full length Clone DNA of Homo sapiens growth arrest and DNA.-damage-inducible, alpha with Flag tag.
Gene Synonym:DDIT1, GADD45, GADD45A
Restriction Site:KpnI + XhoI (5.4kb + 0.55kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

GADD45A is a member of the GADD45 Family, and has been found to associate with several cytoplasmic and nuclear factors and has been implicated in several cellular functions, including MAPK signaling, cell cycle regulation, DNA repair and genomic stability, apoptosis, and immune responses. The GADD45 Family of genes is rapidly induced by different stressors, including differentiation-inducing cytokines, and there is a large body of evidence that their cognate proteins are key players in cellular stress responses. GADD45A protein has been reported to interact with multiple important cellular proteins, including Cdc2 protein kinase, proliferating cell nuclear antigen (PCNA), p21Waf1/Cip1 protein, core histone protein and MTK/MEKK4, an up-stream activator of the JNK/SAPK pathway, indicating that GADD45A may play important roles in the control of cell cycle checkpoint, DNA repair process, and signaling transduction. GADD45A expression in response to genotoxic stress illustrates a more complex scenario, wherein transcriptional changes operate in concert with mRNA turnover and translational regulation. GADD45A was the first stress-inducible gene determined to be up-regulated by p53 and is also a target for the p53 homologues, p63 and p73. The decreased GADD45A expression is also considered a survival mechanism, as cancer cells without this control can evade the apoptotic pathway leading to increased tumourigenesis. As GADD45A is an essential component of many metabolic pathways that control proliferating cancer cells, it presents itself as an emerging drug target worthy of further investigation.

  • Zhan Q. (2005) Gadd45a, a p53- and BRCA1-regulated stress protein, in cellular response to DNA damage. Mutat Res. 569(1-2): 133-43.
  • Lal A, et al. (2006) Egad, more forms of gene regulation: the gadd45a story. Cell Cycle. 5(13): 1422-5.
  • Hoffman B, et al. (2007) Role of gadd45 in myeloid cells in response to hematopoietic stress. Blood Cells Mol Dis. 39(3): 344-7.
  • Rosemary Siafakas A, et al. (2009) Growth arrest and DNA damage-45 alpha (GADD45alpha). Int J Biochem Cell Biol. 41(5): 986-9.