Quick Order

Human SH2D1A ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SH2D1A cDNA Clone Product Information
Gene_bank_ref_id:NM_002351.3
RefSeq ORF Size:387bp
cDNA Description:Full length Clone DNA of Homo sapiens SH2 domain protein 1A with Flag tag.
Gene Synonym:LYP, SAP, XLP, DSHP, EBVS, IMD5, XLPD, MTCP1, FLJ18687, FLJ92177, SH2D1A
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-SH2D1A-flag
Restriction Site:HindIII + XhoI (5.4kb + 0.44kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SH2 domain-containing protein 1A (SH2D1A / SAP) is a 128 amino acid protein, containing a single Src homology 2 (SH2) domain, flanked by 5 amino acids at the N-terminus and 25 amino acids at the C-terminus. The absence of a catalytic domain and the presence of an SH2 domain suggest that SH2D1A regulates one or more signal transduction pathways. SH2D1A interacts with signaling lymphocytic activation molecule (SLAM), which is a transmembrane protein expressed on the surface of activated T and B cells. SH2D1A (SAP) interacts via its SH2 domain with a motif (TIYXXV) present in the cytoplasmic tail of the cell-surface receptors, including CD150 / SLAM, CD84, CD229 / Ly-9, and CD244 / 2B4. SH2D1A was expressed in EBV-carrying, tumor phenotype representative (type I), but not in EBV-carrying lymphoblastoid cell line (LCL)-like (type III) or EBV-negative Burkitt lymphoma (BL) lines. It has been supposed to be related to the X-linked lymphoproliferative disease which is also known as Duncan's disease or Purtilo syndrome. 

References
  • Morra M, et al. (2005) Defective B cell responses in the absence of SH2D1A. PNAS. 102 (13): 4819-23.
  • Morra M, et al. (2001) Characterization of SH2D1A Missense Mutations Identified in X-linked Lymphoproliferative Disease Patients. The Journal of Biological Chemistry. 276: 36809-16.
  • Hron JD, et al. (2004) SH2D1A Regulates T-dependent Humoral Autoimmunity. JEM. 200 (2): 261-6.
  • Size / Price
    Catalog: HG11149-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"