Quick Order

Text Size:AAA

Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A10cDNA Clone Product Information
Gene_bank_ref_id:NM_002966.2
cDNA Size:294
cDNA Description:ORF Clone of Homo sapiens S100 calcium binding protein A10 DNA.
Gene Synonym:42C, P11, p10, GP11, ANX2L, CAL1L, CLP11, Ca[1], ANX2LG, MGC111133, S100A10
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11144-ACG$325
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11144-ACR$325
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11144-ANG$325
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11144-ANR$325
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11144-CF$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11144-CH$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11144-CM$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11144-CY$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone)HG11144-M$95
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11144-M-F$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11144-NF$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11144-NH$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11144-NM$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11144-NY$295
Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11144-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  
Protein S100-A10, also known as Calpactin I light chain, Cellular ligand of annexin II, S100 calcium-binding protein A10, p10 protein, p11, ANX2LG and S100A10, is a member of the S100 family of small, dimeric EF hand-type Ca(2+)-binding proteins that generally modulate cellular target proteins in response to intracellular Ca(2+) signals. In contrast to all other S100 proteins, S100A10 is Ca(2+) insensitive because of amino acid replacements in its Ca(2+)-binding loops that lock the protein in a permanently active state. S100A10 forms a heterotetramer with annexin IIH and promotes carcinoma invasion and metastasis by plasminogen activation. S100A10 and annexin II contribute to the aggressive characteristics of anaplastic carcinoma, while playing a constitutive role in papillary carcinoma. S100A10 induces the dimerization of ANXA2 / p36, it may function as a regulator of protein phosphorylation in that the ANXA2 monomer is the preferred target of tyrosine-specific kinase. S100A10 functions as a linker tethering certain transmembrane proteins to annexin A2 thereby assisting their traffic to the plasma membrane and/or their firm anchorage at certain membrane sites.

References
  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Ito,Y. et al., 2007, Anticancer Res. 27 (4C):2679-83.
  • Svenningsson,P. et al., 2007, Curr Opin Pharmacol  7 (1):27-32.
  • Rescher,U. et al., 2008, Pflugers Arch. 455 (4):575-82.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008,  J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catalog:HG11144-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human S100A10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"