After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A12 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human S100A12 Gene Plasmid Map
Human S100A12 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. 

Protein S100-A12, also known as S100 calcium-binding protein A12, Calcium-binding protein in amniotic fluid 1, Calgranulin-C, and S100A12, is a member of the S-101 family. Like the majority of S100 proteins, S100A12 is a dimer, with the interface between the two subunits being composed mostly of hydrophobic residues. The fold of S100A12 is similar to the other known crystal and solution structures of S100 proteins, except for the linker region between the two EF-hand motifs. S100A12 plays an important role in the inflammatory response.

  • Moroz, OV. et al., 2001, Acta Crystallogr D Biol Crystallogr. 57: 20-9.
  • Foell, D. et al., 2003, Lancet  361 (9365):1270-2.
  • Vogl, T. et al., 2004, Blood. 104: 4260-8.
  • Viemann, D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani, Y. et al., 2005, Mediators Inflamm. 2005: 280-292.
  • Bjoerk, P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Images
    • Human S100A12 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items