Quick Order

Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A16cDNA Clone Product Information
cDNA Size:312
cDNA Description:ORF Clone of Homo sapiens S100 calcium binding protein A16 DNA.
Gene Synonym:AAG13, S100F, DT1P1A7, MGC17528, S100A16
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11137-ACG$325
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11137-ACR$325
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11137-ANG$325
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11137-ANR$325
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11137-CF$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11137-CH$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11137-CM$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11137-CY$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone)HG11137-M$95
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11137-M-F$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11137-NF$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11137-NH$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11137-NM$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11137-NY$295
Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11137-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

S100A16 is a member of S100 protein super family that carries calcium-binding EF-hand motifs. S100 proteins are cell- and tissue-specific and are involved in many intra- and extracellular processes through interacting with specific target proteins. S100A16 expression was found to be astrocyte-specific. The S100A16 protein was found to accumulate within nucleoli and to translocate to the cytoplasm in response to Ca(2+) stimulation. The homodimeric structure of human S100A16 in the apo state has been obtained both in the solid state and in solution, resulting in good agreement between the structures with the exception of two loop regions. The homodimeric solution structure of human S100A16 was also calculated in the calcium(II)-bound form. Differently from most S100 proteins, the conformational rearrangement upon calcium binding is minor. Immunoprecipitation analysis revealed that S100A16 could physically interact with tumor suppressor protein p53, also a known inhibitor of adipogenesis. Overexpression or RNA interference-initiated reduction of S100A16 led to the inhibition or activation of the expression of p53-responsive genes, respectively. S100A16 protein is a novel adipogenesis-promoting factor.

  • Sturchler E, et al. (2006) S100A16, a novel calcium-binding protein of the EF-hand superfamily. J Biol Chem. 281(50): 38905-17.
  • Liu Y, et al. (2011) Identification of S100A16 as a Novel Adipogenesis Promoting Factor in 3T3-L1 Cells. Endocrinology. 152(3): 903-11.
  • Babini E, et al. (2011) Structural characterization of human S100A16, a low-affinity calcium binder. J Biol Inorg Chem. 16(2): 243-56.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human S100A16 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged