Quick Order

Human S100A16 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A16 cDNA Clone Product Information
RefSeq ORF Size:312bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein A16 with Flag tag.
Gene Synonym:AAG13, S100F, DT1P1A7, MGC17528, S100A16
Restriction Site:HindIII + XhoI (5.4kb + 0.36kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

S100A16 is a member of S100 protein super family that carries calcium-binding EF-hand motifs. S100 proteins are cell- and tissue-specific and are involved in many intra- and extracellular processes through interacting with specific target proteins. S100A16 expression was found to be astrocyte-specific. The S100A16 protein was found to accumulate within nucleoli and to translocate to the cytoplasm in response to Ca(2+) stimulation. The homodimeric structure of human S100A16 in the apo state has been obtained both in the solid state and in solution, resulting in good agreement between the structures with the exception of two loop regions. The homodimeric solution structure of human S100A16 was also calculated in the calcium(II)-bound form. Differently from most S100 proteins, the conformational rearrangement upon calcium binding is minor. Immunoprecipitation analysis revealed that S100A16 could physically interact with tumor suppressor protein p53, also a known inhibitor of adipogenesis. Overexpression or RNA interference-initiated reduction of S100A16 led to the inhibition or activation of the expression of p53-responsive genes, respectively. S100A16 protein is a novel adipogenesis-promoting factor.

  • Sturchler E, et al. (2006) S100A16, a novel calcium-binding protein of the EF-hand superfamily. J Biol Chem. 281(50): 38905-17.
  • Liu Y, et al. (2011) Identification of S100A16 as a Novel Adipogenesis Promoting Factor in 3T3-L1 Cells. Endocrinology. 152(3): 903-11.
  • Babini E, et al. (2011) Structural characterization of human S100A16, a low-affinity calcium binder. J Biol Inorg Chem. 16(2): 243-56.
  • Size / Price
    Catalog: HG11137-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions