Quick Order

Text Size:AAA

Human UBE3A transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human E6AP cDNA Clone Product Information
Gene_bank_ref_id:NM_130838.1
RefSeq ORF Size:2559bp
cDNA Description:Full length Clone DNA of Homo sapiens ubiquitin protein ligase E3A, transcript variant 1.
Gene Synonym:AS, ANCR, E6-AP, HPVE6A, EPVE6AP, FLJ26981, UBE3A
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-E6AP
Restriction Site:KpnI + NotI (5.5kb + 2.56kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human E6AP Gene Plasmid Map
Human UBE3A transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG11130-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"