Quick Order

Text Size:AAA

Human CDK17 / PCTK2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PCTK2 cDNA Clone Product Information
RefSeq ORF Size:1572bp
cDNA Description:Full length Clone DNA of Homo sapiens PCTAIRE protein kinase 2.
Gene Synonym:PCTAIRE2
Restriction Site:KpnI (two restriction sites) + XhoI (5.5kb + 1.06kb + 0.51kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PCTK2 Gene Plasmid Map
Human CDK17 / PCTK2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG11126-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions