Quick Order

Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CAMK2GcDNA Clone Product Information
cDNA Size:1557
cDNA Description:ORF Clone of Homo sapiens calcium/calmodulin-dependent protein kinase II gamma, transcript variant 3 DNA.
Gene Synonym:CAMK, CAMKG, CAMK-II, FLJ16043, MGC26678, CAMK2G
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 147 G/A not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11125-ACG$345
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11125-ACR$345
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11125-ANG$345
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11125-ANR$345
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11125-CF$315
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11125-CH$315
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11125-CM$315
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11125-CY$315
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone)HG11125-M$295
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11125-M-F$495
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11125-NF$315
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11125-NH$315
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11125-NM$315
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11125-NY$315
Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11125-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $495.00  (Save $180.00)
Price:$315.00      [How to order]
Availability5 business days
  • Human CAMK2G transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items