Quick Order

Human ACBD6 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACBD6 cDNA Clone Product Information
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Homo sapiens acyl-Coenzyme A binding domain containing 6 with Flag tag.
Gene Synonym:MGC2404, ACBD6
Restriction Site:KpnI + XhoI (5.4kb + 0.9kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Human acyl-coenzyme A binding domain-containing member 6 (ACBD6) is a modular protein that carries an acyl-CoA binding domain at its N terminus and two ankyrin motifs at its C terminus. In mammals, there are six members of the acyl-CoA binding domain-containing (ACBD) family, and their annotation is not uniform. All six ACBD proteins contain an ACB domain at the N terminus, but they do not share significant homology at the C-terminal region. ACBD6 is a 32 kDa protein that is predicted by sequence analysis to carry an ACB domain between residues 42 and 125 and two ANK motifs at its C terminus. This protein binds long-chain acyl-CoAs with a strong preference for unsaturated, C18:1-CoA and C20:4-CoA, over saturated, C16:0-CoA, acyl species. ACBD6 is not a ubiquitous protein, but it is expressed in hematopoietic tissues and appears to be restricted to primitive stem cells present in those tissues with functions in blood and vessel development. ACBD6 was detected in bone marrow, spleen, placenta, cord blood, circulating CD34+ progenitors, and embryonic-like stem cells derived from placenta. In placenta, the protein was only detected in CD34+ progenitor cells present in blood and in CD31+ endothelial cells surrounding the blood vessels. These cells were also positive for the marker CD133, and they probably constitute hemangiogenic stem cells, precursors of both blood and vessels. We propose that human ACBD6 represents a cellular marker for primitive progenitor cells with functions in hematopoiesis and vascular endothelium development.

  • Soupene E, et al. (2008) Characterization of an acyl-coenzyme A binding protein predominantly expressed in human primitive progenitor cells. J Lipid Res. 49(5): 1103-12.
  • Size / Price
    Catalog: HG11112-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions