Quick Order

Human SERPINF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SerpinF1cDNA Clone Product Information
cDNA Size:1257
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 DNA.
Gene Synonym:PEDF, EPC-1, PIG35
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.