Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SLAMF8 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human SLAMF8 Gene Plasmid Map
Human SLAMF8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

The signaling lymphocyte activation molecule (SLAM) family includes homophilic and heterophilic receptors that modulate both adaptive and innate immune responses. These receptors share a common ectodomain organization: a membrane-proximal immunoglobulin constant domain and a membrane-distal immunoglobulin variable domain that is responsible for ligand recognition. SLAM family of receptors is expressed by a wide range of immune cells. Through their cytoplasmic domain, SLAM family receptors associate with SLAM-associated protein (SAP)-related molecules, a group of cytoplasmic adaptors composed almost exclusively of an SRC homology 2 domain. SLAM family receptors, in association with SAP family adaptors, have crucial roles during normal immune reactions in innate and adaptive immune cells.
Mouse SLAM family member 8, also known as B-lymphocyte activator macrophage expressed, BCM-like membrane protein, SLAMF8 and BLAME, is a single-pass type I  membrane protein. It contains one Ig-like C2-type (immunoglobulin-like) domain. SLAMF8 / BLAME is expressed in lymph node, spleen, thymus and bone marrow. It may play a role in B-lineage commitment and/or modulation of signaling through the B-cell receptor.

References
  • Kingsbury G.A., et al., 2001, J. Immunol. 166:5675-80.
  • Zhang Z., et al., 2004, Protein Sci. 13: 2819-24.
  • Veillette,A. et al., 2006, Nat Rev Immunol  6 (1): 56-66.
  • Veillette,A. et al., 2006, Trends Immunol  27 (5): 228-34.
  • Yan,Q. et al., 2007, Proc Natl Acad Sci. USA.104 (25):10583-8.
  • Images
    • Human SLAMF8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"