After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human LRPAP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LRPAP1cDNA Clone Product Information
cDNA Size:1074
cDNA Description:ORF Clone of Homo sapiens low density lipoprotein receptor-related protein associated protein 1 DNA.
Gene Synonym:RAP, MRAP, A2RAP, HBP44, A2MRAP, MGC138272
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Wnt Receptor Related Products

Receptor-associated protein (RAP) is a molecular chaperone for low density lipoprotein receptor-related protein (LRP), which plays a key role in cholesterol metabolism. The lipoprotein receptor-related protein (LRP) is an endocytic receptor for several ligands, such as alpha2-macroglobulin (alpha2 M) and apolipoprotein E. LRP is involved in the clearance of lipids from the bloodstream and is expressed in the atherosclerotic plaque. The LRP-associated protein (LRPAP in humans, RAP in mice) acts as a chaperone protein, stabilizing the nascent LRP peptide in the endoplasmic reticulum and Golgi complex. Alpha-2-macroglobulin receptor-associated protein, also known as low density lipoprotein receptor-related protein-associated protein 1, RAP and LRPAP1, is a 39 kDa protein and a member of the alpha-2-MRAP family. It is a receptor antagonist that interacts with several members of the low density lipoprotein (LDL) receptor gene family. Upon binding to these receptors, LRPAP1 inhibits all ligand interactions with the receptors. LRPAP1 is present on cell surface forming a complex with the alpha-2-macroglobulin receptor heavy and light chains. It binds with LRP1B and the binding is followed by internalization and degradation. LRPAP1 interacts with LRP1/alpha-2-macroglobulin receptor and LRP2 (previously called glycoprotein 330), and may be involved in the pathogenesis of membrane glomerular nephritis. LRPAP1 together with LRP2 forms the Heymann nephritis antigenic complex. LRP2 is expressed in epithelial cells of the thyroid, where it can serve as a receptor for the protein thyroglobulin. Intron 5 insertion/deletion polymorphism of RAP gene (LRPAP1) has been implicated in other diseases sharing etiology with gallstone disease (GSD). The LRPAP1 insertion/deletion polymorphism influences cholesterol homeostasis and may confer risk for gallstone disease and gallbladder carcinoma (GBC) incidence usually parallels with the prevalence of cholelithiosis. The genetic variations at the LRPAP1 locus may modulate Alzheimer disease (AD) phenotype beyond risk for disease. In addition, the variation at the LRPAP1 gene could contribute to the risk of developing an early episode of myocardial infarction (MI).

  • Gonzlez P, et al. (2002) Variation in the lipoprotein receptor-related protein, alpha2-macroglobulin and lipoprotein receptor-associated protein genes in relation to plasma lipid levels and risk of early myocardial infarction. Coron Artery Dis. 13(5): 251-4.
  • Schutte DL, et al. (2003) A LRPAP1 intronic insertion/deletion polymorphism and phenotypic variability in Alzheimer disease. Res Theory Nurs Pract. 17(4): 301-19?
  • Pandey SN, et al. (2006) Lipoprotein receptor associated protein (LRPAP1) insertion/deletion polymorphism: association with gallbladder cancer susceptibility. Int J Gastrointest Cancer. 37(4): 124-8.
  • Dixit M, et al. (2006) Association of low density lipoprotein receptor related protein-associated protein (LRPAP1) gene insertion/deletion polymorphism with gallstone disease.J Gastroenterol Hepatol. 21(5): 847-9.