Quick Order

Human SMYD2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SMYD2/KMT3C cDNA Clone Product Information
Gene_bank_ref_id:NM_020197.2
RefSeq ORF Size:1302bp
cDNA Description:Full length Clone DNA of Homo sapiens SET and MYND domain containing 2.
Gene Synonym:KMT3C, HSKM-B, ZMYND14, MGC119305, SMYD2
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-SMYD2
Restriction Site:HindIII + XhoI (5.5kb + 1.3kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

SET and MYND domain-containing protein 2, also known as HSKM-B, SMYD2, and KMT3C, is a member of the SMYD protein family. It contains one MYND-type zinc finger and one SET domain. Not much is known about SMYD2. However, the interest in better understanding the roles of SMYD2 has grown because of reports indicating that SMYD2 methylates p53 and histone H3. In Xenopus, SMYD1 and SMYD2 were expressed in various muscle tissues and related to muscle cells differentiation. SMYD2 mRNA is most highly expressed in heart and brain tissue. Over-expressed SMYD2 localizes to the cytoplasm and the nucleus in 293T cells. SMYD2 appears to restrain cell proliferation, likely through direct modulation of chromatin structure. Patients with SMYD2-overexpressing tumors had a worse overall rate of survival than those with non-expressing tumors, and SMYD2 positivity was independently associated with a worse outcome in the multivariate analysis. SMYD2 plays an important role in tumor cell proliferation through its activation/overexpression and regards as a prognosticator and potential therapeutic target in esophageal squamous cell carcinoma (ESCC).

Size / Price
Catalog: HG11093-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"