After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
INSR/CD220cDNA Clone Product Information
cDNA Size:4149
cDNA Description:ORF Clone of Homo sapiens insulin receptor transcript variant 1 DNA.
Gene Synonym:HHF5, CD220, INSR
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 1650G/A, 3042C/T and 3255C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11081-ACG$475
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11081-ACR$475
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11081-CF$445
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11081-CH$445
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11081-CM$445
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11081-CY$445
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG11081-M$495
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11081-M-F$745
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11081-NF$445
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11081-NH$445
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11081-NM$445
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11081-NY$445
Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11081-UT$445
 Learn more about expression Vectors

INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

Size / Price
List Price: $745.00  (Save $300.00)
Price:$445.00      [How to order]
Availability5 business days
  • Human INSR transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items