Quick Order

Human PADI4 ORF mammalian expression plasmid, Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PADI4 cDNA Clone Product Information
RefSeq ORF Size:1992bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidyl arginine deiminase, type I V with Myc tag.
Gene Synonym:PAD, PAD4, PDI4, PDI5, PADI5, PADI4
Restriction Site:KpnI + XbaI (5.4kb + 2.04kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations 245 T/C and 349 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PADI4 Gene Plasmid Map
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged
pCMV2-Myc Vector Information
Vector Name pCMV2-Myc
Vector Size 5598bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Protein-arginine deiminase type-4, also known as HL-60 PAD, Peptidylarginine deiminase IV, Protein-arginine deiminase type I V and PADI4, is a cytoplasm and nucleus protein which belongs to the protein arginine deiminase family. PADI4 is expressed in CD34+ stem cells in normal tissues, and many more CD34+ cells expressing PADI4 are present in tumour tissues. PADI4 post-translationally converts peptidylarginine to citrulline, a process called citrullination. Studies have demonstrated the high expression of PADI4 in various malignant tumour tissues. PADI4 is also expressed at high levels in the blood of patients with some malignant tumours. Citrullination of histone, cytokeratin, antithrombin and fibronectin have been confirmed to be involved in abnormal apoptosis, high coagulation, and disordered cell proliferation and differentiation, all of which are main features of malignant tumours. PADI4 may play an important role in tumourigenesis. Genetic variations in PADI4 are a cause of susceptibility to rheumatoid arthritis (RA). It is a systemic inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures.

  • Nakashima K. et al.,1999, J. Biol. Chem. 274: 27786-92.
  • Suzuki A. et al., 2003, Nat. Genet. 34:395-402.
  • Nakayama-Hamada M. et al., 2005, Biochem. Biophys. Res. Commun. 327:192-200.
  • Chang, X. et al., 2010, Cancer Cell Int  10:7.
  • Size / Price
    Catalog: HG11072-M-M
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions