Quick Order

Human SCARB1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SCARB1 cDNA Clone Product Information
NCBI RefSeq:NM_005505.4
RefSeq ORF Size:1529bp
cDNA Description:Full length Clone DNA of Homo sapiens scavenger receptor class B, member 1.
Gene Synonym:CLA1, SRB1, CLA-1, SR-BI, CD36L1, MGC138242, SCARB1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-SCARB1
Restriction Site:KpnI + XbaI (5.5kb + 1.53kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutation: 501C/T and 1050T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SCARB1 Gene Plasmid Map
Human SCARB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Scavenger receptor class B, member 1 (SCARB1), also known as CD36L1, is a member of the scavenger receptor family. SCARB1 is expressed primarily in liver and non placental steroidogenic tissues, and predominantly localized to cholesterol and sphingomyelin-enriched domains within the plasma membrane. SCARB1 is proposed as a receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells, and is involved in a wide variety of physilogical processes. As a key component in the reverse cholesterol transport pathway, SCARB1 binds high density lipoproteins (HDLs) and mediates selective cholesterol uptake by a mechanism distinct from the LDL pathway. High density lipoproteins (HDLs) play a critical role in cholesterol metabolism and their plasma concentrations are inversely correlated with risk for atherosclerosis. SCARB1 may thus serve as a useful marker that predicts variation in baseline lipid levels and postprandial lipid response. The mouse SCARB1 has been shown to exert actions in determining the levels of plasma lipoprotein cholesterol and the accumulation of cholesterol stores in the adrenal gland.

References
  • Murao, K. et al., 1997, J. Biol. Chem. 272(28): 17551-17557.
  • Ikemoto, M. et al., 2000, Proc. Natl. Acad. Sci. U.S.A. 97 (12): 6538-6543.
  • Husemann, J. et al., 2001, Am. J. Pathol. 158 (3): 825-832. 
  • Williams, D.L. et al., 2001, Endocr. Res. 26 (4): 639-651.
  • Bulte, B. S. et al., 2002, J. Biol. Chem. 277 (39): 36092-36099.
  • Duncan, K.G. et al., 2002, Biochem. Biophys. Res. Commun. 292 (4): 1017-1022. 
  • Size / Price
    Catalog: HG11069-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"