Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SCARB2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human SCARB2 Gene Plasmid Map
Human SCARB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Lysosomal Integral Membrane Protein II (LIMPII), also known as SCARB2, LPG85, and CD36L2, is a type I II multi-pass membrane glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes on all tissues and cell types so far examined. This protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. LIMPII is identified as a receptor for EV71 (human enterovirus species A, Enterovirus 71) and CVA16 (coxsackievirus A16) which are most frequently associated with hand, foot and mouth disease (HFMD). Expression of human LIMPII enables normally unsusceptible cell lines to support the viruses’ propagation and develop cytopathic effects. In addition, LIMPII also has been shown to bind thrombospondin-1, may contribute to the pro-adhesive changes of activated platelets during coagulation, and inflammation. Deficiency of the protein in mice impairs cell membrane transport processes and causes pelvic junction obstruction, deafness, and peripheral neuropathy.

  • Crombie, R. et al., 1998, J. Biol. Chem. 273: 4855-4863.
  • Febbraio, M. et al., 2001, J. Clin. Invest. 108: 785-791.
  • Kuronita, T. et al., 2002, J. Cell Sci. 115: 4117-4131.
  • Gamp, A.C. et al., 2003, Human Molecular Genetics. 12: 631-646.
  • Eskelinen, E.L. et al., 2003, Trends in Cell Biology. 13: 137-145.
  • Mulcahy, J.V. et al.,2004, Biochem. J. 377 (Pt 3): 741–747.
  • Yamayoshi, S. et al., 2009, Nat Med. 15 (7): 798-801.
  • Images
    • Human SCARB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items