Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPR56 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Liu M., et al., 1999, Genomics 55: 296-305.
  • Huang,Y. et al., 2008, Mol Cell Biochem. 308 (1-2):133-9.
  • Li,S. et al., 2008, J Neurosci 28 (22):5817-26.
  • Jin,Z. et al., 2009, Prog Mol Biol Transl Sci. 89 :1-13.
  • Xu,L. et al., 2010, Clin Exp Metastasis. 27 (4):241-9.
  • Images
    • Human GPR56 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items