After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CROT natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CROT cDNA Clone Product Information
NCBI RefSeq:NM_021151.2
RefSeq ORF Size:1839bp
cDNA Description:Full length Clone DNA of Homo sapiens carnitine O-octanoyltransferase.
Gene Synonym:ARP2, HARP, MGC8889, ANGPTL2
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-CROT
Restriction Site:KpnI + XhoI (5.5kb + 1.84kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1420G/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CROT Gene Plasmid Map
Human CROT Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Carnitine octanoyltransferase (CROT or COT), also known as octanoyl-CoA: L-carnitine O-octanoyltransferase, medium-chain/long-chain carnitine acyltransferase, and carnitine medium-chain acyltransferase, is a carnitine acyltransferase belonging to the family of transferases, specifically those acyltransferases transferring groups other than aminoacyl groups that catalyzes the reversible transfer of fatty acyl groups between CoA and carnitine. Carnitine octanoyltransferase (CROT or COT) facilitate the transport of medium- and long-chain fatty acids through the peroxisomal and mitochondrial membranes. It is physiologically inhibited by malonyl-CoA. COT also has functions in efficiently converting one of the end products of the peroxisomal beta-oxidation of pristanic acid, 4, 8-dimethylnonanoyl-CoA, to its corresponding carnitine ester. 

References
  • Ferdinandusse S, et al. (1999) Molecular cloning and expression of human carnitine octanoyltransferase: evidence for its role in the peroxisomal beta-oxidation of branched-chain fatty acids. Biochem Biophys Res Commun. 263 (1): 213-8.
  • Feike R, et al. (2000) Genomics of the Human Carnitine Acyltransferase Genes. Molecular Genetics and Metabolism. 71 (1-2): 139-53.
  • Montserrat Morillas, et al. (2002) Structural Model of a Malonyl-CoA-binding Site of Carnitine Octanoyltransferase and Carnitine Palmitoyltransferase I. The Journal of Biological Chemistry, 277: 11473-80.
  • Size / Price
    Catalog: HG11015-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"