Quick Order

Text Size:AAA

Human CCNA1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCNA1cDNA Clone Product Information
cDNA Size:1398
cDNA Description:ORF Clone of Homo sapiens cyclin A1 DNA.
Gene Synonym:CCNA1
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Cyclin A1 is a member of the highly conserved cyclin family that is characterized by a dramatic periodicity in protein abundance, and belongs to the A-type cyclin subfamily. The mammalian A-type cyclin family consists of two members: cyclin A1 and cyclin A2. Different cyclins exhibit distinct expression. Cyclin A1 is expressed in mice exclusively in the germ cell lineage and high rate of cyclinA1 is found in human testis and certain myeloid leukaemia cells. Cyclin A1 is primarily function in the control of meiosis. It serves as regulator subunits binding to cyclin-dependent kinase 1 (Cdk1) and cyclin-dependent kinase 2 (Cdk2), which give two different kinase activities, one appearing in S phase, the other in G2. Through this, cyclin A1 operate the entry and progression in cell cycle. High frequency of cyclin A1 overexpression has been observed in acute myelocytic leukemias, especially those that are at the promyelocyte and myeloblast stages of development.

  • Yang R, et al. (1999) Functions of Cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins. Molecular and Cellular biology. 19 (3): 2400-7.
  • Yang R, et al. (1999) Cyclin A1 expression in leukemia and normal hematopoietic cells. Blood. 93 (6): 2067-74.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human CCNA1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items