Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD20/MS4A1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human CD20/MS4A1 Gene Plasmid Map
Human MS4A1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.
  • Images
    • Human MS4A1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    Recently Viewed Items