After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SERPINB8 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SerpinB8 cDNA Clone Product Information
Gene_bank_ref_id:NM_002640.3
RefSeq ORF Size:1125bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 8 with Flag tag.
Gene Synonym:PI8, CAP2
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-SERPINA8-flag
Restriction Site:KpnI + XhoI (5.4kb + 1.18kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SerpinB8 Gene Plasmid Map
Human SERPINB8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
Mouse SerpinB8, also known as Cytoplasmic antiproteinase 2, Peptidase inhibitor 8, SerpinB8, PI-8, SERPINB8 and CAP2, is a member of the Serpin superfamily. SERPINB8 was broadly expressed. In normal neuroendocrine tissues, strongest SerpinB8 expression was detected in islets of Langerhans of the pancreas. Moderate SerpinB8 expression was observed in neuroendocrine cells of the thyroid, adrenal cortex, colon, and pituitary gland. In the pancreas, SerpinB8 is specifically expressed by insulin-producing beta cells, and can be used as an additional diagnostic immunohistochemical marker. Mouse SerpinB8 distribution alters during kidney regeneration, possibly to control a prohormone convertase involved in inflammation or tissue repair.

References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, P.J. et al., 2009, Pancreas. 38 (4): 461-7.
  • Size / Price
    Catalog: HG10999-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"