Quick Order

Text Size:AAA

Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
PAFcDNA Clone Product Information
Gene Bank Ref.ID:NM_014736.4
cDNA Size:336
cDNA Description:ORF Clone of Homo sapiens platelet-activating factor DNA.
Gene Synonym:L5, PAF, OEATC1, NS5ATP9, OEATC-1, p15(PAF), KIAA0101
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV2-FLAG Physical Map
Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

KIAA0101, also known as p15(PAF), is a proliferating cell nuclear antigen-associated factor which interacts with proliferating cell nuclear antigen(PCNA). It was initially isolated in a yeast two-hybrid screen for PCNA binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21(WAF). KIAA0101 is localized primarily in the nucleus. It shares the conserved PCNA binding motif with several other PCNA binding proteins including CDK inhibitor p21 . KIAA0101 is involved in cell proliferation and plays a role in early tumor recurrence (ETR), and prognosis of hepatocellular carcinoma (HCC). KIAA0101 is expressed predominantly in liver, pancreas and placenta. It cannot be detected in heart or brain. It is highly expressed in a number of tumors, especially esophageal tumors, in anaplastic thyroid carcinomas and in non-small-cell lung cancer lines. Overexpression of KIAA0101 predicts high stage, early tumor recurrence, and poor prognosis of hepatocellular carcinoma. It also may be involved in protection of cells from UV-induced cell death.

  • Yu P, et al. (2001) p15(PAF), a novel PCNA associated factor with increased expression in tumor tissues. Oncogene. 20 (4): 484-9.
  • Simpson F, et al. (2005) The PCNA-associated factor KIAA0101/p15(PAF) binds the potential tumor suppressor product p33ING1b. Exp Cell Res. 312 (1): 73-85.
  • Guo M, et al. (2006) KIAA0101 (OEACT-1), an expressionally down-regulated and growth-inhibitory gene in human hepatocellular carcinoma. BMC Cancer. 6: 109.
  • Nagase T, et al. (1995) Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2 (1): 37-43.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:5 business days
    • Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged