Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NAMPT cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human NAMPT Gene Plasmid Map
Human NAMPT Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Nicotinamide phosphoribosyltransferase (NAMPT), also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin, is an enzyme belonging to the family of glycosyltransferases, to be specific, the pentosyltransferases. This enzyme participates in nicotinate and nicotinamide metabolism. This enzyme catalyzes the condensation of nicotinamide with 5- phosphoribosyl-1- pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. NAMPT is also considered as an essential enzyme mediating granulocyte colony-stimulating factor (G-CSF)-triggered granulopoiesis in healthy individuals and in individuals with severe congenital neutropenia. Intracellular NAMPT and NAD+ amounts in myeloid cells, as well as plasma NAMPT and NAD+ levels, were increased by G-CSF treatment of both healthy volunteers and individuals with congenital neutropenia.

References
  • Skokowa J, et al. (2009) NAMPT is essential for the G-CSF-induced myeloid differentiation via a NAD+-sirtuin-1-dependent pathway. Nat Med. 15(2): 151-8.
  • Samal B, et al. (1994) Cloning and characterization of the cDNA encoding a novel human pre-B-cell colony-enhancing factor. Mol Cell Biol. 14 (2): 1431-7.
  • Images
    • Human NAMPT Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"