Quick Order

Human NAMPT Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAMPTcDNA Clone Product Information
cDNA Size:1476
cDNA Description:ORF Clone of Homo sapiens nicotinamide phosphoribosyltransferase DNA.
Gene Synonym:VF, PBEF, PBEF1, VISFATIN, MGC117256
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 903A/G not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Nicotinamide phosphoribosyltransferase (NAMPT), also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin, is an enzyme belonging to the family of glycosyltransferases, to be specific, the pentosyltransferases. This enzyme participates in nicotinate and nicotinamide metabolism. This enzyme catalyzes the condensation of nicotinamide with 5- phosphoribosyl-1- pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. NAMPT is also considered as an essential enzyme mediating granulocyte colony-stimulating factor (G-CSF)-triggered granulopoiesis in healthy individuals and in individuals with severe congenital neutropenia. Intracellular NAMPT and NAD+ amounts in myeloid cells, as well as plasma NAMPT and NAD+ levels, were increased by G-CSF treatment of both healthy volunteers and individuals with congenital neutropenia.

  • Skokowa J, et al. (2009) NAMPT is essential for the G-CSF-induced myeloid differentiation via a NAD+-sirtuin-1-dependent pathway. Nat Med. 15(2): 151-8.
  • Samal B, et al. (1994) Cloning and characterization of the cDNA encoding a novel human pre-B-cell colony-enhancing factor. Mol Cell Biol. 14 (2): 1431-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human NAMPT Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    Recently Viewed Items