Quick Order

Text Size:AAA

Human NAMPT Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAMPTcDNA Clone Product Information
Gene_bank_ref_id:NM_005746.2
cDNA Size:1476
cDNA Description:ORF Clone of Homo sapiens nicotinamide phosphoribosyltransferase DNA.
Gene Synonym:VF, PBEF, PBEF1, VISFATIN, MGC117256
Species:Human
Vector:pCMV2-FLAG
Restriction Site:KpnI + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 903A/GA not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Nicotinamide phosphoribosyltransferase (NAMPT), also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin, is an enzyme belonging to the family of glycosyltransferases, to be specific, the pentosyltransferases. This enzyme participates in nicotinate and nicotinamide metabolism. This enzyme catalyzes the condensation of nicotinamide with 5- phosphoribosyl-1- pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. NAMPT is also considered as an essential enzyme mediating granulocyte colony-stimulating factor (G-CSF)-triggered granulopoiesis in healthy individuals and in individuals with severe congenital neutropenia. Intracellular NAMPT and NAD+ amounts in myeloid cells, as well as plasma NAMPT and NAD+ levels, were increased by G-CSF treatment of both healthy volunteers and individuals with congenital neutropenia.

References
  • Skokowa J, et al. (2009) NAMPT is essential for the G-CSF-induced myeloid differentiation via a NAD+-sirtuin-1-dependent pathway. Nat Med. 15(2): 151-8.
  • Samal B, et al. (1994) Cloning and characterization of the cDNA encoding a novel human pre-B-cell colony-enhancing factor. Mol Cell Biol. 14 (2): 1431-7.
  • Size / Price
    Catalog:HG10990-M-F
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human NAMPT Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"