Quick Order

Text Size:AAA

Human ACTN2 ORF mammalian expression plasmid, Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACTN2 cDNA Clone Product Information
RefSeq ORF Size:2685bp
cDNA Description:Full length Clone DNA of Homo sapiens actinin, alpha 2 with Myc tag.
Gene Synonym:CMD1AA,
Restriction Site:KpnI + XhoI (5.4kb + 2.74kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ACTN2 Gene Plasmid Map
Human ACTN2 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged
pCMV2-Myc Vector Information
Vector Name pCMV2-Myc
Vector Size 5598bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Size / Price
Catalog: HG10972-M-M
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions