Quick Order

Text Size:AAA

Human Integrin beta2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ITGB2cDNA Clone Product Information
Gene_bank_ref_id:NM_000211.3
cDNA Size:2310
cDNA Description:ORF Clone of Homo sapiens integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) DNA.
Gene Synonym:LAD, CD18, MF17, MFI7, LCAMB, LFA-1, MAC-1
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 24 G/T, 819 G/A and 1323 T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Size / Price
Catalog:HG10970-M-N
List Price: $345.00  (Save $30.00)
Price:$315.00      [How to order]
Availability5 business days
Images
  • Human Integrin beta2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"