After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ACPP ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACPP cDNA Clone Product Information
RefSeq ORF Size:1257bp
cDNA Description:Full length Clone DNA of Homo sapiens acid phosphatase, prostate with Flag tag.
Gene Synonym:PAP, ACP3, ACP-3
Restriction Site:KpnI + XhoI (5.4kb + 1.31kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Prostatic acid phosphatase (PAP, or ACPP), also known as prostatic specific acid phosphatase (PSAP), is an enzyme produced by the prostate. As a non-specific phosphomonoesterase, Prostatic acid phosphatase synthetized and secreted into seminal plasma under androgenic control. The enzyme is a dimer of molecular weight around 100 kDa. Prostatic acid phosphatase is a clinically important protein for its relevance as a biomarker of prostate carcinoma. Furthermore, it has a potential role in fertilization. The major action of PAP is to dephosphorylate macromolecules with the help of catalytic residues (His(12) and Asp(258)) that are located in the cleft between two domains. Cellular prostatic acid phosphatase (cPAcP), an authentic tyrosine phosphatase, is proposed to function as a negative growth regulator of prostate cancer (PCa) cells in part through its dephosphorylation of ErbB-2. cPAcP functions as a neutral protein tyrosine phosphatase (PTP) in prostate cancer cells and dephosphorylates HER-2/ErbB-2/Neu (HER-2: human epidermal growth factor receptor-2) at the phosphotyrosine (p-Tyr) residues. Injection of the secretory isoform of PAP has potent antinociceptive effects in mouse models of chronic pain. This enzyme exhibits ecto-5'-nucleotidase activity, is widely distributed, and implicated in the formation of chronic pain. Additionally, PAP could be a target molecule in specific immunotherapy for patients with nonprostate adenocarcinomas including colon and gastric cancers.

  • Hassan MI, et al. (2010) Structural and functional analysis of human prostatic acid phosphatase. Expert Rev Anticancer Ther. 10(7): 1055-68.
  • Chuang TD, et al. (2010) Human prostatic acid phosphatase, an authentic tyrosine phosphatase, dephosphorylates ErbB-2 and regulates prostate cancer cell growth. J Biol Chem. 285(31): 23598-606.
  • Larsen RS, et al. (2009) A high throughput assay to identify small molecule modulators of prostatic acid phosphatase. Curr Chem Genomics. 3: 42-9.
  • Zimmermann H. (2009) Prostatic acid phosphatase, a neglected ectonucleotidase. Purinergic Signal. 5(3): 273-5.
  • Wang Y, et al. (2005) Prostatic acid phosphatase as a target molecule in specific immunotherapy for patients with nonprostate adenocarcinoma. J Immunother. 28(6): 535-41.
  • Veeramani S, et al. (2005) Cellular prostatic acid phosphatase: a protein tyrosine phosphatase involved in androgen-independent proliferation of prostate cancer. Endocr Relat Cancer. 12(4): 805-22.
  • Ostrowski WS, et al. (1994) Human prostatic acid phosphatase: selected properties and practical applications. Clin Chim Acta. 226(2): 121-9.
  • Size / Price
    Catalog: HG10959-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions