After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human A2M natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human A2M cDNA Clone Product Information
Gene_bank_ref_id:NM_000014.4
RefSeq ORF Size:4425bp
cDNA Description:Full length Clone DNA of Homo sapiens alpha-2-macroglobulin.
Gene Synonym:CPAMD5, FWP007, S863-7, DKFZp779B086
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-A2M
Restriction Site:HindIII + XbaI (5.5kb + 4.43kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human A2M Gene Plasmid Map
Human A2M Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

alpha-2-macroglobulin, also known as α2-macroglobulin (α2M and A2M), is an abundant protein of the plasma of vertebrates and members of several invertebrate phyla and functions as a broad-spectrum protease-binding protein. alpha-2-macroglobulin is produced by the liver, and is a major component of the alpha-2 band in protein electrophoresis. alpha-2-macroglobulin is a large plasma glycoprotein that has long been known as an irreversible inhibitor of a variety of proteinases. More recently, it has been reported that numerous growth factors, cytokines and hormones bind to alpha 2M through diverse mechanisms. A2M is also produced in the brain where it binds multiple extracellular ligands and is internalized by neurons and astrocytes. In the brain of Alzheimer's disease (AD) patients, A2M has been localized to diffuse amyloid plaques. A2M also binds soluble beta-amyloid, of which it mediates degradation. Protease-conjugated alpha2-macroglobulin is selectively bound by cells contacting the body fluids and alpha2-macroglobulin and its protease cargo are then internalized and degraded in secondary lysosomes of those cells. In addition to this function as an agent for protease clearance, alpha2-macroglobulin binds a variety of other ligands, including several peptide growth factors and modulates the activity of a lectin-dependent cytolytic pathway in arthropods.

References
  • Kovacs DM. (2000) alpha2-macroglobulin in late-onset Alzheimer's disease. Exp Gerontol. 35(4): 473-9.
  • Armstrong PB, et al. (1999) Alpha2-macroglobulin: an evolutionarily conserved arm of the innate immune system. Dev Comp Immunol. 23(4-5): 375-90.
  • Feige JJ, et al. (1996) Alpha 2-macroglobulin: a binding protein for transforming growth factor-beta and various cytokines. Horm Res. 45(3-5): 227-32.
  • Size / Price
    Catalog: HG10952-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"