Quick Order

Text Size:AAA

Human GDF-15 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GDF-15 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human GDF-15 Gene Plasmid Map
Human GDF-15 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.


Growth-differentiation factor 15 (GDF15), also known as MIC-1, is a secreted member of the transforming growth factor (TGF)-β superfamily, as a novel antihypertrophic regulatory factor in the heart. GDF-15 / GDF15 is not expressed in the normal adult heart but is induced in response to conditions that promote hypertrophy and dilated cardiomyopathy and it is expressed highly in liver. GDF-15 / GDF15 has a role in regulating inflammatory and apoptotic pathways in injured tissues and during disease processes. GDF-15 / GDF15 is synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein. GDF-15 / GDF15 overexpression arising from an expanded erythroid compartment contributes to iron overload in thalassemia syndromes by inhibiting hepcidin expression.

  • Ago T, et al. (2006) GDF15, a cardioprotective TGF-beta superfamily protein. Circ Res. 98 (3): 294-297.
  • Hsiao E, et al. (2000) Characterization of growth-differentiation factor 15, a transforming growth factor beta superfamily member induced following liver injury. Mol Cell Biol. 20 (10): 3742-51.
  • Zimmers T, et al. (2005) Growth differentiation factor-15/macrophage inhibitory cytokine-1 induction after kidney and lung injury. Shock. 23 (6): 543-8.