After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FCN1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FCN1 cDNA Clone Product Information
RefSeq ORF Size:981bp
cDNA Description:Full length Clone DNA of Homo sapiens ficolin (collagen/fibrinogen domain containing) 1 with Flag tag.
Gene Synonym:FCNM,
Restriction Site:KpnI + XhoI (5.4kb + 1.03kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 570C/T and 825G/A not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FCN1 Gene Plasmid Map
Human FCN1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. The Ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. Three Ficolins have been identified in humans: L-Ficolin, H-Ficolin and M-Ficolin (also referred to as Ficolin-2, -3 and -1, respectively). They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Dysfunction or abnormal expressions of Ficolins may involved in the pathogenesis of human diseases including infectious and inflammatory diseases, autoimmune disease and clinical syndrome of preeclampsia. They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Upon recognition of the infectious agent, the Ficolins act through two distinct routes: initiate the lectin pathway of complement activation through attached serine proteases (MASPs), and a primitive opsonophagocytosis thus limiting the infection and concurrently orchestrating the subsequent adaptive clonal immune response. Ficolin-1 (FCN1) is predominantly expressed in the peripheral blood leukocytes.

  • Thiel S. (2007) Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins. Mol Immunol. 44(16): 3875-88.
  • Zhang XL, et al. (2008) Ficolins: structure, function and associated diseases. Adv Exp Med Biol. 632: 105-15.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Size / Price
    Catalog: HG10930-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions