After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CDH16 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDH16 cDNA Clone Product Information
NCBI RefSeq:NM_004062.2
RefSeq ORF Size:2490bp
cDNA Description:Full length Clone DNA of Homo sapiens cadherin 16, KSP-cadherin with Flag tag.
Gene Synonym:CDH16
Restriction Site:HindIII + XbaI (5.4kb + 2.54kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CDH16 Gene Plasmid Map
Human CDH16 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

KSP-Cadherin/Cadherin-16 is a member of the cadherin superfamily, calcium-dependent, membrane-associated glycoproteins. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. KSP-Cadherin/Cadherin-16 can be detected at later stages of tubulogenesis during human renal development and in the distal tubules of adult kidneys, no expression was found by immunohistochemistry or Western blot analysis in RCC tumour tissues and several RCC cell lines. However, despite the lack of protein expression, mRNA synthesis of KSP-Cadherin/Cadherin-16 could be detected by reverse transcriptase-polymerase chain reaction analysis in all RCC tissues and most of the RCC cell lines studied, although at a reduced level. The loss of KSP-Cadherin/Cadherin-16 protein was only observed in the malignant part of the tumour kidneys, whereas in the normal part of the affected kidneys KSP-Cadherin/Cadherin-16 expression was clearly detected. These results indicate a downregulation of Ksp-cadherin in RCC and suggest a role for this cell adhesion molecule in tumour suppression.

  • Thomson RB, et al. (1999) Immunolocalization of Ksp-cadherin in the adult and developing rabbit kidney. Am J Physiol. 277 (1): 146-56.
  • Thedieck C, et al. (2005) Expression of Ksp-cadherin during kidney development and in renal cell carcinoma. Br J Cancer. 92(11): 2010-7.
  • Bai Y, et al. (2002) Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta. Am J Physiol Renal Physiol. 283(4): 839-51.
  • Size / Price
    Catalog: HG10915-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.