After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human OSTM1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human OSTM1 cDNA Clone Product Information
RefSeq ORF Size:1005bp
cDNA Description:Full length Clone DNA of Homo sapiens osteopetrosis associated transmembrane protein 1 with Flag tag.
Gene Synonym:GL, GIPN, OPTB5, HSPC019,
Restriction Site:HindIII + XhoI (5.4kb + 1.06kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Osteopetrosis-associated transmembrane protein 1 (OSTM1) is a Single-pass type I  membrane protein. It is expressed in many hematopoietic cells of the myeloid and lymphoid B- and T-lineages. The analysis of OSTM1 association with CLCN7 demonstrated that OSTM1 requires CLCN7 to localize to lysosomes, whereas the formation of a CLCN7-OSTM1 complex is required to stabilize CLCN7. The researches found that OSTM1 plays a major role in myelopoiesis and lymphopoiesis and provided evidence of a crosstalk mechanism between hematopoietic cells for osteoclast activation. Thus, OSTM1 has a important role in osteoclast function and activation. The loss of function of OSTM1 results in deregulation of multiple hematopoietic lineages in addition to osteoclast lineage, OSTM1-defect patients display the most severe recessive osteopetrotic phenotype and die at early ages. Furthermore, it is suggested that OSTM1 has a primary role in neural development not related to lysosomal dysfunction. The canonical Wnt/beta-catenin signaling pathway may be a molecular basis for OSTM1 mutations and severe autosomal recessive osteopetrosis (ARO).


1.  Chalhoub, N. et al., 2003, Nat Med. 9 (4): 399-406.

2.  Quarello, P. et al., 2004, J Bone Miner Res. 19 (7): 1194-1199.

3.  Lange, PF. et al., 2006, Nature. 440 (7081): 220-223

4.  Maranda, B. et al., 2008, J Bone Miner Res. 23 (2): 296-300.

5.  Feigin, al., 2008, Cell Signal. 20 (5): 949-957.  

6.  Pata, al., 2008, J Biol Chem. 283 (45): 30522-30530. 

Size / Price
Catalog: HG10913-M-F
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions