After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCNE1 natural ORF mammalian expression plasmid, HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCNE1 cDNA Clone Product Information
RefSeq ORF Size:1233bp
cDNA Description:Full length Clone DNA of Homo sapiens cyclin E1 with HA tag.
Gene Synonym:CCNE1
Restriction Site:KpnI + XhoI (5.5kb + 1.26kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CCNE1 Gene Plasmid Map
Human CCNE1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Cyclin E1 is a member of the highly conserved cyclin family and belongs to the E-type cyclin that functions as a regulator of S phase entry and progression in mammalian cells. Cyclin E1 serves as regulatory subunits that bind, activate, and provide substrate for its associated cyclin-dependent kinase2 (CDK2), whose activity is essential for cell cycle G1 / S transition. Over expression of this encoding gene has been found in many tumors, which results in chromosome instability and by extension, induce tumorigenesis. This protein was also found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. In general, cyclin E1, as an activator of phospho-CDK2 (pCDK2), is important for cell cycle progression and is frequently overexpressed in cancer cells.

  • Honda R, et al. (2005) The structure of cyclin E1 / CDK2: implications for CDK2 activation and CDK2-independent roles. The EMBO Journal. 24: 452-63.
  • Geng Y, et al. (2007) Kinase-Independent Function of Cyclin E. 25(1): 127-39.
  • Size / Price
    Catalog: HG10902-M-Y
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions