Quick Order

Human CDK5 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDK5 cDNA Clone Product Information
RefSeq ORF Size:879bp
cDNA Description:Full length Clone DNA of Homo sapiens cyclin-dependent kinase 5.
Gene Synonym:PSSALRE
Restriction Site:HindIII + XbaI (5.5kb + 0.88kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Cell division protein kinase 5, also known as Cyclin-dependent kinase 5, Serine/threonine-protein kinase PSSALRE, Tau protein kinase II catalytic subunit, TPKII catalytic subunit and CDK5, is a cytoplasm protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and CDC2 / CDKX subfamily. Cyclin-dependent kinases (Cdks) are a family of proline-directed Ser/Thr kinases known for their role in the control of cell cycle progression. In 1992, this family was joined by CDK5, which is an atypical member in that it uses its own activators and is multifunctional, playing important regulatory roles in multiple cellular functions. CDK5, unlike other Cdks, is not regulated by cyclins, and its activity is primarily detected in postmitotic neurons in developing and adult nervous systems. CDK5 is activated by association with a neuron-specific activator, p35 or its isoform p39. CDK5 is probably involved in the control of the cell cycle. It interacts with D1 and D3-type G1 cyclins. CDK5 can phosphorylate histone H1, tau, MAP2 and NF-H and NF-M. It also interacts with p35 which activates the kinase. CDK5 plays important roles in various neuronal activities, including neuronal migration, synaptic activity, and neuronal cell death.

  • Smith,D.S. et al., 2001, Cell Growth Differ. 12 (6):277-83.
  • Mapelli,M. et al., 2003, Neurosignals.  12 (4-5):164-72.
  • Cheng,K. et al., 2003, Neurosignals. 12 (4-5):180-90.
  • Fischer,A. et al., 2003, Curr Drug Targets CNS Neurol Disord 2 (6): 375 - 81.
  • Lalioti,V. et al., 2010, Cell Cycle  9 (2): 284-311.
  • Size / Price
    Catalog: HG10897-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions