Quick Order

Human Smad3 natural ORF mammalian expression plasmid, HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human Smad3 cDNA Clone Product Information
RefSeq ORF Size:1278bp
cDNA Description:Full length Clone DNA of Homo sapiens SMAD family member 3 with HA tag.
Gene Synonym:MADH3, JV15-2, HSPC193
Restriction Site:KpnI + XhoI (5.5kb + 1.31kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

SMAD3 belongs to the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD3 is involved in cell signalling. It modulates signals of activin and TGFβ's. Binding of SMAD3 with SMAD4 enables its transmigration into the nucleus where it forms complexes with other proteins and acts as a transcription factor. SMAD3 is a receptor-regulated SMAD (R-SMAD). In mice, mutation of SMAD3 has been linked to colorectal adenocarcinoma, increased systemic inflammation, and accelerated wound healing. Increased SMAD3 activity has been implicated in the pathogenesis of scleroderma. Smad3 is also a multifaceted regulator in adipose physiology and the pathogenesis of obesity and type 2 diabetes.

  • Tan. et al., 2011, Diabetes. 60 (2): 464-76.
  • Yang X. et al., 1999, Nat Cell Biol. 1 (5): 260-6.
  • Zhu Y. et al., 1998, Cell. 94 (6): 703-14.
  • Feng X. et al., 1996, Nature. 383 (6596): 168-72.
  • Size / Price
    Catalog: HG10892-M-Y
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions