Quick Order

Human CXCL9 ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CXCL9 cDNA Clone Product Information
RefSeq ORF Size:378bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 9 with His tag.
Gene Synonym:CMK, MIG, Humig, SCYB9, crg-10, CXCL9
Restriction Site:KpnI + XhoI (5.5kb + 0.41kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.


Chemokine (C-X-C motif) ligand 9 (CXCL9), also known as Monokine induced by gamma interferon (MIG), is a small cytokine belonging to the CXC chemokine family. The function of this chemokine has not been specifically defined; however, it is thought to be involved in T cell trafficking. CXCL9/MIG functions as one of the three ligands of chemokine receptor CXCR3 which is a G protein-coupled receptor found predominantly on T cells. CXCL9/MIG, together with CXCL10 and CXCL11, may activate CXCR3 by binding to it. CXCL9 serves as a cytokine that affects the growth, movement, or activation state of cells that participate in immune and inflammatory response. It has been observed that tumour endothelial cells secrete high levels of CXCL9 in all, and CXCL10 in most melanoma metastases. Experiment data represent novel mechanisms by which tumour cells in melanoma metastases might use the chemokine-expressing endothelium to leave the tumour and eventually to form additional metastases at distinct sites. Experiment results also improved that CXCL9/MIG plays an important role in CD4+ T lymphocyte recruitment and development of CAV, MOMA-2+ macrophages are the predominant recipient-derived source of CXCL9/MIG, and recipient CD4 lymphocytes are necessary for sustained CXCL9/MIG production and CAV development in this model. Neutralization of the chemokine CXCL9/MIG may have therapeutic potential for the treatment of chronic rejection after heart transplantation.

  • Ruehlmann JM, et al. (2001) MIG (CXCL9) chemokine gene therapy combines with antibody-cytokine fusion protein to suppress growth and dissemination of murine colon carcinoma. Cancer Res. 61(23): 8498-503.
  • Belperio JA, et al. (2003) Role of CXCL9/CXCR3 chemokine biology during pathogenesis of acute lung allograft rejection. J Immunol. 171(9): 4844-52.
  • Colvin RA, et al. (2004) Intracellular domains of CXCR3 that mediate CXCL9, CXCL10, and CXCL11 function. J Biol Chem. 279(29): 30219-27.
  • Valbuena G, et al. (2003) Expression analysis of the T-cell-targeting chemokines CXCL9 and CXCL10 in mice and humans with endothelial infections caused by rickettsiae of the spotted fever group. Am J Pathol. 163(4): 1357-69.
  • Size / Price
    Catalog: HG10888-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions