After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ENPP7 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human ENPP7 Gene Plasmid Map
Human ENPP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Mouse Ectonucleotide pyrophosphatase / phosphodiesterase family member 7, also known as Alkaline sphingomyelin phosphodiesterase, Intestinal alkaline sphingomyelinase, Alk-Smase, ENPP7 and NPP-7, is a single-pass type I membrane protein which belongs to the nucleotide pyrophosphatase / phosphodiesterase family. ENPP7 / NPP-7 is expressed in the intestines and human bile. ENPP7 / NPP-7 is localized at the surface of the microvillar membrane in small intestine enterocytes, as well as in endosome-like structures and in Golgi complex. The main function of ENPP7 / NPP-7 is to convert the dietary sphingomyelin into ceramide, the sphingolipid messengers via hydrolyzation. ENPP7 / NPP-7 is also reported to exert a phospholipase C activity toward palmitoyl lyso-phosphocholine. The activity of this enzyme is inhibited in a dose dependent manner by ATP, imidazole, orthovanadate and zinc ion. Further, It has been shown in studies that decreased levels of ENPP7 / NPP-7 may be associated with human colon cancer.

References
  • Wu J. et al., 2005, Biochem. J. 386:153-60.
  • Wu J. et al., 2004, Carcinogenesis 25:1327-33.
  • Duan R.-D. et al., 2003, J. Lipid Res. 44:1241-50.
  • Duan R.-D. et al., 2003, J. Biol. Chem. 278:38528-36.
  • Images
    • Human ENPP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"