After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human METAP1D / MAP1D ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAP1D cDNA Clone Product Information
Gene_bank_ref_id:NM_199227.1
RefSeq ORF Size:1008bp
cDNA Description:Full length Clone DNA of Homo sapiens methionine aminopeptidase 1D with Flag tag.
Gene Synonym:AT4G37040, METHIONINE
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-MAP1D-Flag
Restriction Site:HindIII + XhoI (5.4kb + 1.06kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MAP1D Gene Plasmid Map
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Methionine aminopeptidase 1D, also known as MAP1D, is a member of the peptidase M24A family. N-terminal methionine removal is an important cellular process required for proper biological activity, subcellular localization, and eventual degradation of many proteins. The enzymes that catalyze this reaction are called Methionine aminopeptidases (MAPs). MAP1D is overexpressed in colon cancer cell lines and colon tumors as compared to normal tissues (at protein level). Downregulation of MAP1D expression by shRNA in HCT-116 colon carcinoma cells reduces anchorage-independant growth in soft agar. MAP1D binds two cobalt ions per subunit. The true nature of the physiological cofactor is under debate. MAP1D is also active with zinc, manganese or divalent ions. MAP1D removes the amino-terminal methionine from nascent proteins. It may also play an important role in colon tumorigenesis.

Size / Price
Catalog: HG10883-M-F
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"