After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CXCL1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CXCL1 cDNA Clone Product Information
RefSeq ORF Size:324bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) with Flag tag.
Gene Synonym:FSP, GRO1, GROa, MGSA, NAP-3, SCYB1, MGSA-a, CXCL1
Restriction Site:KpnI + XhoI (5.4kb + 0.37kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

The Chemokine (C-X-C motif) Ligand 1, CXCL1, is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GRO?, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-a). CXCL1 already known to be important in osteoarthritis (OA), as a novel target gene of transcription factor AP-2? in chondrocytes and support the important role of AP-2? in cartilage. CXCL1 is a potent neutrophil chemoattractant with recognized roles in angiogenesis and inflammation. CXCL1 is a novel immediate PTH/PTHrP-responsive gene. CXCL1 may act as a chemoattractant for osteoclast precursors. CXCL1 may also have important pro-nociceptive effects via its direct actions on sensory neurons, and may induce long-term changes that involve protein synthesis. CXCL1 plays a critical nonredundant role in the development of experimental Lyme arthritis and carditis via CXCR2-mediated recruitment of neutrophils into the site of infection. CXCL1 functions through CXCR2 to transactivate the EGFR by proteolytic cleavage of HB-EGF, leading to activation of MAPK signalling and increased proliferation of epithelial ovarian cancer (EOC) cells. It might limit tumor growth by reinforcing senescence early in tumorigenesis. Thus, CXCL1 plays a role in spinal cord development by inhibiting the migration of oligodendrocyte precursors and is involved in the processes of angiogenesis, inflammation, wound healing, and tumorigenesis.

  • Wang JG, et al. (2008) The chemokine CXCL1/growth related oncogene increases sodium currents and neuronal excitability in small diameter sensory neurons. Mol Pain. 4: 38.
  • Acosta JC, et al. (2009) A role for CXCR2 in senescence, but what about in cancer? Cancer Res. 69(6): 2167-70.
  • Onan D, et al. (2009) The chemokine Cxcl1 is a novel target gene of parathyroid hormone (PTH)/PTH-related protein in committed osteoblasts. Endocrinology. 150(5): 2244-53.
  • Ritzman AM, et al. (2010) The chemokine receptor CXCR2 ligand KC (CXCL1) mediates neutrophil recruitment and is critical for development of experimental Lyme arthritis and carditis. Infect Immun. 78(11): 4593-600.
  • Bolitho C, et al. (2010) The chemokine CXCL1 induces proliferation in epithelial ovarian cancer cells by transactivation of the epidermal growth factor receptor. Endocr Relat Cancer. 17(4): 929-40.
  • Wenke AK, et al. (2011) The transcription factor AP-2? regulates CXCL1 during cartilage development and in osteoarthritis. Osteoarthritis Cartilage. 19(2): 206-12.
  • Size / Price
    Catalog: HG10877-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions