After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HPX cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human HPX Gene Plasmid Map
Human HPX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Images
  • Human HPX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"