Quick Order

Text Size:AAA

Human LAIR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LAIR2cDNA Clone Product Information
cDNA Size:459
cDNA Description:ORF Clone of Homo sapiens leukocyte-associated immunoglobulin-like receptor 2 DNA.
Gene Synonym:CD306, MGC71634
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Leukocyte-associated immunoglobulin-like receptor 2 ( LAIR2 ), also known as CD306, is a 131 amino acid protein containing one lg-like C2-type domain. It is expressed as a soluble receptor exhibiting high affinity for various collagen molecules to which it binds in a hydroxyproline-dependent manner. LAIR2 is a member of the immunoglobulin superfamily and was identified by its similarity to LAIR1, an inhibitory receptor present on mononuclear leukocytes. LAIR2 is thought to be secreted and may help modulate mucosal tolerance. As a natural competitor for LAIR1, soluble LAIR2 prevents binding of human LAIR1 to collagens and LAIR1 cross-linking, thereby regulating its inhibitory potential. Accordingly, LAIR2 is suggested to perform an immunoregulatory function.

  • Meyaard, L. et al.,1997, Immunity.7:283-290.
  • Meyaard, L. et al.,1999, J. Immunol. 162:5800-5804.
  • Meyaard, L. et al., 2001,  J. Exp. Med. 194 (1): 107-112.
  • Meyaard, L., 2003, J Biol Regul Homeost Agents.  17 (4): 330-333.
  • Lebbink, R. J. et al., 2008, J Immunol. 180 (3):1662-1669.
  • Lebbink,R.J. et al., 2009,  Matrix Biol.  28 (4):202-210.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human LAIR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items