Quick Order

Human LAIR2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LAIR2cDNA Clone Product Information
cDNA Size:459
cDNA Description:ORF Clone of Homo sapiens leukocyte-associated immunoglobulin-like receptor 2 DNA.
Gene Synonym:CD306, MGC71634
Restriction Site:HindIII + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Leukocyte-associated immunoglobulin-like receptor 2 ( LAIR2 ), also known as CD306, is a 131 amino acid protein containing one lg-like C2-type domain. It is expressed as a soluble receptor exhibiting high affinity for various collagen molecules to which it binds in a hydroxyproline-dependent manner. LAIR2 is a member of the immunoglobulin superfamily and was identified by its similarity to LAIR1, an inhibitory receptor present on mononuclear leukocytes. LAIR2 is thought to be secreted and may help modulate mucosal tolerance. As a natural competitor for LAIR1, soluble LAIR2 prevents binding of human LAIR1 to collagens and LAIR1 cross-linking, thereby regulating its inhibitory potential. Accordingly, LAIR2 is suggested to perform an immunoregulatory function.

  • Meyaard, L. et al.,1997, Immunity.7:283-290.
  • Meyaard, L. et al.,1999, J. Immunol. 162:5800-5804.
  • Meyaard, L. et al., 2001,  J. Exp. Med. 194 (1): 107-112.
  • Meyaard, L., 2003, J Biol Regul Homeost Agents.  17 (4): 330-333.
  • Lebbink, R. J. et al., 2008, J Immunol. 180 (3):1662-1669.
  • Lebbink,R.J. et al., 2009,  Matrix Biol.  28 (4):202-210.