Quick Order

Human IL8Ra / CXCR1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL8Ra/CXCR1 cDNA Clone Product Information
NCBI RefSeq:NM_000634.2
RefSeq ORF Size:1053bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 8 receptor, alpha with Flag tag.
Gene Synonym:C-C, CD128, CD181, CKR-1, CXCR1, IL8R1, CMKAR1, IL8RBA, CDw128a, C-C-CKR-1, IL8RA
Restriction Site:KpnI + XhoI (5.4kb + 1.1kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL8Ra/CXCR1 Gene Plasmid Map
Human IL8Ra / CXCR1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human IL8Ra/CXCR1 Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human IL8Ra / CXCR1 natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Rhesus CD122 / IL-2RB Protein (Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Rhesus CD122 / IL-2RB Protein (His Tag)Mouse IL7 / Interleukin 7 ProteinMouse CD123 / IL3RA Protein (ECD, His Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL13 / ALRH Protein (Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Mouse IL2RG Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (Fc Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinCynomolgus IL13 / ALRH ProteinMouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Human Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL4R / CD124 Protein (His Tag)Human IL13RA1 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Human IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Human IL3RA / CD123 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse IL2RG / CD132 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman IL-9 / Interleukin-9 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-3 / Interleukin-3 Protein (His Tag)Mouse IL2RA / CD25 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human Interleukin-21 / IL-21 ProteinHuman IL13 / ALRH ProteinMouse IL-4R / CD124 Protein (ECD, His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinHuman IL2RG / CD132 Protein (His Tag)Mouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Rat IL9R / Interleukin 9 receptor Protein (His Tag)Canine IL5 Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinCanine IL4 / Interleukin-4 ProteinMouse IL21 / Interleukin 21 ProteinCanine IL21 / Interleukin 21 ProteinRat IL4R / Il4ra Protein (His Tag)Human IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL13RA1 Protein (Fc Tag)Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL13RA2 / IL13R Protein (His Tag)Canine IL-8 / CXCL8 ProteinMouse IL13 / ALRH ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Human IL7 / interleukin 7 ProteinRat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Rhesus IL-8 / CXCL8 ProteinMouse IL5Ra / CD125 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL21 / Interleukin 21 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Cynomolgus IL2RA Protein (His Tag)Rat IL7R / IL7RA Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Cynomolgus IL2RA ProteinCanine IL13RA2 / IL13R Protein (Fc Tag)Human IL5 / Interleukin 5 ProteinMouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Rat IL7 / interleukin 7 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-15 / IL15 / Interleukin 15 ProteinHuman IL-8 / CXCL8 Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.