Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NXPH1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human NXPH1 Gene Plasmid Map
Human Neurexophilin-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Neurexophilin-1, or NXPH1 is a secreted glycoprotein, which belongs to the Neurexophilin family. The Neurexophilin family contain at least four genes and resembles a neuropeptide, suggesting a function as an endogenous ligand for alpha-neurexins. The mammalian brains contain four genes for neurexophilins the products of which share a common structure composed of five domains: an N-terminal signal peptide, a variable N-terminal domain, a highly conserved central domain that is N-glycosylated, a short linker region, and a conserved C-terminal domain that is cysteine-rich. Neurexophilin-1 constitutes a secreted cysteine-rich glycoprotein, forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. Neurexophilins 1 and 3 but not 4 (neurexophilin 2 is not expressed in rodents) bind to a single individual LNS domain, the second overall LNS domain in all three alpha-neurexins.

  • Missler M, et al. (1998) Neurexophilin binding to alpha-neurexins. A single LNS domain functions as an independently folding ligand-binding unit. J Biol Chem. 273(52): 34716-23.
  • Missler M, et al. (1998) Neurexophilins form a conserved family of neuropeptide-like glycoproteins. J Neurosci. 18(10): 3630-8.
  • Petrenko AG, et al. (1996) Structure and evolution of neurexophilin. J Neurosci. 16(14): 4360-9.
  • Images
    • Human Neurexophilin-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items