Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MFG-E8cDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

MFG-E8, also known as lactadherin and MFGE8, contains 1 EGF-like domain and 2 F5/8 type C domains. It also contains a phosphatidylserine (PS) binding domain, as well as an Arginine-Glycine-Aspartic acid motif, which enables the binding to integrins. It binds PS, which is exposed on the surface of apoptotic cells. MFG-E8 is expressed in mammary epithelial cell surfaces and aortic media. Overexpression of MFG-E8 can be found in several carcinomas. MFG-E8 has an opsonization of the apoptotic cells and binding to integrins on the surface of phagocytic cells. It also mediates the engulfment of the dead cell. MFG-E8 plays an important role in the maintenance of intestinal epithelial homeostasis and the promotion of mucosal healing. It promotes VEGF-dependent neovascularization and contributes to phagocytic removal of apoptotic cells in many tissues. It also binds to phosphatidylserine-enriched cell surfaces in a receptor-independent manner.

  • Oshima K, et al. (2002) Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles. Eur J Biochem. 269(4):1209-18.
  • Hanayama R, et al. (2002) Identification of a factor that links apoptotic cells to phagocytes. Nature. 417 (6885):182-7.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    • Human MFG-E8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items